Keywords
|
| Insulinoma; Islets of Langerhans; Nerve Growth Factor; Polymerase Chain Reaction |
Abbreviations
|
| BDNF: brain-derived neurotrophic factor; DMEM: Dulbecco’s modified Eagle’s medium; FCS: fetal calf serum; GAPDH: glyceraldehyde-3-phosphate dehydrogenases; HS: horse serum; MMLV: Moloney murine leukemia virus; NT: neurotrophins; RPMI: Rosweli Park Memorial Institute; Trk: tyrosine-receptor kinase |
INTRODUCTION
|
| It has recently been demonstrated that pancreatic beta-cells express functional receptors for nerve growth factor (NGF) and that NGF exerts some effects on beta-cells such as the induction of neuron-like differentiation, the stimulation of sodium current and the enhancement of early responsive gene expression (i.e. NGF-1A and c-fos) [1, 2, 3, 4, 5]. NGF exerts its biological effects on neuronal cells through specific cell surface receptors: p75NTR (p75), which is the low affinity NGF receptor whose function has not yet been completely elucidated, and gp140Trk-A (Trk-A, tyrosine-receptor kinase A), which is the high affinity NGF receptor which combines with p75NGFR to form a receptor complex with full biological activity [6]. The expression of both high- and low-affinity receptors for NGF has been demonstrated in different insulinoma cell lines and in fetal rat islets, while the expression of Trk-A has been also demonstrated in adult islets [7, 8]. The cellular localization of Trk-A and NGF is developmentally regulated, suggesting that the neurotrophin system may play an important role in beta-cell development. Little is known about the expression and role of the other neurotrophins and their relative receptors in pancreatic beta cells [3, 5, 9]. |
| The aim of the present study was to characterize the pattern of expression of neurotrophins and their receptors in pancreatic beta-cells and in pertinent insulinoma cell lines expression. |
METHODS
|
Cells Cultures
|
| Islet preparations were obtained from 6-monthold mice. The pancreases were excised from 3 mice and digested as previously described [10]. Subsequently the islets were handpicked under a stereomicroscope. Cells, free of exocrine tissue, were cultured in Rosweli Park Memorial Institute (RPMI) 1640 medium (Gibco-BRL, Gaithersburg, MD, USA) as previously described [10]. |
| BetaTC6-F7 cells (kindly provided by Dr. Shimon Efrat, Tel Aviv University, Israel) obtained from transgenic mice expressing SV40 large-T antigen under control of the insulin promoter, were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco- BRL, Gaithersburg, MD, USA) supplemented with 15% horse serum (HS), 5% fetal calf serum (FCS) and 2 mM glutamine and used at passages 35-50 where physiological glucose responsiveness is maintained [11]. RIN 1046- 38 cells were cultured in M199 medium (Gibco-BRL, Gaithersburg, MD, USA) supplemented with 10% FCS and 2mM glutamine. RIN cells were used at passages 19- 25 in which glucose responsiveness is maintained [12]. INS-1 cells (passages 85-92) were cultured in RPMI 1640 medium, 1 mM sodium pyruvate, 50 mM beta-mercaptoethanol, 10% FCS and 5% HS. HIT-T15 cells (passages 72-82), a clonal hamster cell line, were cultured in RPMI 1640 medium supplemented with 10% FCS and 2.5 mg amphotericin B. |
| All the culture media contained 11.1 mmol glucose, 50 IU penicillin and 50 mg/mL streptomycin. Cells were subcultured once a week and maintained at 37 °C in an atmosphere of 95% humidified air and 5% CO2. |
RNA Preparation and RT-PCR Analysis
|
| RNA was extracted by the guanidium thiocyanate method [13] and used for reverse transcription–polymerase chain reaction analysis (RT-PCR). Briefly, 1 mg RNA was reverse transcribed for 1 hour at 42 °C using 200 U Moloney murine leukemia virus (MMLV) reverse transcriptase (Gibco-BRL, Gaithersburg, MD) in the presence of 2.5 mM random hexamers and 200 mM nucleotides (Amersham Pharmacia Biotech, Cologno Monzese, MI, Italy) in 20 mL final volume. Successively, 2 mL of each cDNA were PCR amplified using 2.5 U Platinum Taq except for p75NTR for which 2.5 U Hot Start (Qiagen SpA, Milan, Italy), was used in the presence of 15 pmol of specific primers. To normalize cDNA amounts used during the PCR amplification, a parallel amplification was performed using glyceraldehyde-3-phosphate dehydrogenases (GAPDH) specific primers (not shown). |
| After a 5 min denaturation step, PCR cycles consisted of 30 sec denaturation, 30 sec annealing and 1 min extension (5 min final extension) were performed using a Perkin Elmer 2400 thermal cycler (Perkin Elmer Corporation, Norwalk, CN, USA). The number of cycles depended on the relative abundance of each target analyzed and is indicated below. Primer sequences were as follows: NGF forward 5’-AAGGACGCAGCTTTCTATAC and reverse 5'-TGTGGAAGACTGGGTGGGT (60 cycles); brain-derived neurotrophic factor (BDNF) forward 5'- ATGGGACTCTGGAGAGCGTGAA and reverse 5'-CGCCAGCCAATTCTCTTTTTGC (50 cycles); neurotrophins 3 (NT3) forward 5'- CTTATCTCCGTGGCATCCAAGG and reverse 5'-TCTGAAGTCAGTGCTCGGACGT (55 cycles); neurotrophins 4 (NT4) forward 5'- TTCTGGCTCCTGAGTGGAC and reverse 5'- AGTCAACGCCCG-CACATAG (50 cycles); Trk-A forward 5'- GTGCTCAATGAGACCAGC-TTC and reverse 5'-CTTCAGTGCCCTTGACAGCCAC (50 cycles); Trk-B+ forward 5'- TACTGGGACGTTGGGAATTTGG and reverse 5'-CCCTCTTCAGAACGATGTTGTG (45 cycles); Trk-B- forward 5'- TACTGGGACGT-TGGGAATTTGG and reverse 5'-CCTTTATCTCAGCTACCCATCC (60 cycles); Trk-C forward 5'- TGGACTGGATAGTCACTGG and reverse 5’- TGGGTCACAGTGATAGGAG (45 cycles); p75 forward 5'-GAGCCACCAGAGCGTGTG and reverse 5'-GGGGATGTGGCAGTGGAC (60 cycles). The number of cycles indicated were used in pilot experiments to allow PCR amplification in the linear range. |
ETHICS
|
| Animals used for islet preparations received humane care according to the standard criteria outlined in the “Guide for the Care and Use of Laboratory Animals” as prepared by the National Academy of Sciences. |
STATISTICS
|
| No statistical evaluation of the data was performed due to the qualitative nature of this study. |
RESULTS
|
| RT-PCR analysis demonstrated a cell-specific pattern of neurotrophin/neurotrophin receptor expression (Figure 1). In particular, NGF mRNA expression is virtually limited to islets and betaTC6-F7 cells. It is barely detectable in RIN and undetectable in the other cell lines. |
| BDNF and NT4 mRNA expression is present in all groups. NT3 mRNA is expressed in all groups but is barely detectable in betaTC6-F7 cells. |
| Concerning the pattern of neurotrophin receptor expression, Trk-A mRNA is uniformly expressed, although less so in islets and betaTC6-F7 cells. Trk-B+ mRNA is not expressed in islets and in HIT-T15 cells while Trk-B- mRNA is absent in HIT-T15 cells and barely detectable in islets; TrkC mRNA is expressed in all groups, although to a lesser degree represented in RIN cells. Finally, p75 mRNA is expressed in islets and in all the cell lines, and is less abundant in RIN and HIT cells. |
| Although this was not a quantitative study, the amount of RNA from each cell line used for RT-PCR was normalized. Therefore the amplitude of bands and the number of PCR cycles applied to get uniform bands for a given target are consistent with differences in the mRNA contents. In particular, NGF mRNA required 60 cycles while BDNF or NT4 required only 50 cycles to obtain a comparable signal. Similarly, p75 was clearly detectable after 40 cycles, while the kinase minus isoform of Trk-B required 60 cycles. |
DISCUSSION
|
| The family of neurotrophic factors includes NGF, the first neurotrophin identified, BDNF, NT3 and NT4. Signal transduction by these neurotrophins is initiated by binding to specific high affinity tyrosine-kinase receptors, called Trk-A for NGF and NT3, Trk-B for BDNF and Trk-C for NT4. All the neurotrophins interact with the low affinity receptor p75, whose role in the neurotrophin signal transduction is not completely elucidated [14]. |
| NGF and BDNF are expressed in a limited number of peripheral tissues [15]; in particular NGF has been detected in lymphocytes and pancreatic beta-cells [3, 16], while BDNF has been identified in dorsal root ganglia [17]. On the contrary, NT3 is almost omnipresent being localized in the heart, kidney, gut, lung, spleen, liver, muscle, skin, secretory cells of the submandibular gland and epithelial cells of secondary and tertiary follicles in the ovary [18]. |
| Neurotrophin 4/5 (NT4/5) is a member of the neurotrophin family known to influence survival and to have other effects on a variety of neuronal cells. Although NT4/5 mRNA has been found in various effector tissues of the rat and human, the concentration of NT4/5 protein in tissues has not been previously reported due to the lack of a suitable methodology. A recently developed quantitative two-site enzyme-linked immunosorbent assay for the estimation of NT4/5 in pre- and postnatal rat tissues showed that NT4/5 is present in most embryonic tissues but was rarely detectable in postnatal tissues, with the notable exception of the testis [19]. |
| Previous studies have demonstrated the expression of high- and low-affinity receptors for NGF in pancreatic islets and in various betacell lines as well as in numerous non-neuronal tissues by both Northern blot analysis and binding studies [1, 3, 4, 9, 20]. Trk-B receptor has been found only in truncated forms in nonneural tissues such as the spleen, submandibular gland, testes, kidney and pituitary gland [21]. On the contrary, Trk-C has been found in the thymus, lung, kidney, stomach and testes with discordant data regarding findings of truncated or full-length receptor forms. Recently the presence of fulllength Trk-C mRNA and protein has been demonstrated in INS-1 cells, where NT3 determines an increase in intracellular free calcium and is not followed by changes in insulin secretion [22]. |
| The present study points out that in islets the pattern of neurotrophin/neurotrophin receptor expression includes all the neurotrophins with Trk-A and C mRNAs. On the contrary, in the beta-cell lines, NGF mRNA expression is lacking except in betaTC6-F7 cells. In RIN cells it is expressed at a very low level. Trk-A and C are omnipresent, even though less abundant in RIN cells, while Trk-B is lacking in HIT cells. Finally, islets express the low affinity receptor for NGF as well as betaTC6- F7 cells and RIN cells, while it is less abundant in INS and HIT cells. |
| These data suggest that islets and betaTC6-F7 cells share a common pattern of neurotrophin expression which is unusual as compared to the other tested cell lines tested due to the presence of NGF. Similarly, islets share a common pattern of expression with INS-1 and HIT cells relative to the NT3/TrkC axis. |
| We hypothesize that NGF and NT3 can act at the level of pancreatic beta-cells by independent autocrine loops which can be relevant for beta-cell functioning and we suggest that betaTC6-F7 cells represent a unique model for studies on the NGF mechanism of action. In addition, INS-1 and HIT-T15 cells are useful tools for studies of the mechanism of action of NT3. |
| Considerable evidence has recently been provided indicating a role for NGF in pancreas development and maturation. In fact, it has been demonstrated that inhibition of the tyrosine-kinase activity of the NGF receptors causes an impairment of islet morphogenesis [4]; NGF receptor expression in beta-cells is regulated by prolactin and/or the growth hormone, two hormones which are involved in pancreas development and beta-cell function [23]. Furthermore, NGF has been demonstrated to induce neuron-like differentiation in betacells [5, 9, 24]. Finally, NGF increases gp140Trk-A expression in islets, suggesting that the NGF autocrine effects are mediated through activation of gp140Trk-A [2]. The role of p75NTR in beta-cells has not yet been clarified. The NGF low affinity receptor is considered to be involved in the modulation of apoptosis/survival in neurons which is consistent with its structural similarity to Fas/Apo-1, tumor necrosis factor receptors I and II and CD40 [25, 26, 27] . Based on these data, it can be hypothesized that NGF plays a role in the modulation of apoptosis/survival of islet beta-cells. Beta cell susceptibility to apoptosis influences the occurrence of diabetes by reducing the beta-cell mass [28, 29] . Therefore, the understanding of the mechanisms influencing this highly regulated process is extremely important. |
| In conclusion, we have characterized the neurotrophin/neurotrophin receptor pattern of expression in a panel of beta-cells, providing basic information as to the possible role of neurotrophic factors in the regulation of beta-cell apoptosis/survival. Furthermore, we have determined the cellular models useful for studies in this field. |
Figures at a glance
|
 |
| Figure 1 |
|
References
|
- Miralles F, Philippe P, Czernichow P, Scharfmann R. Expression of nerve growth factor and its high-affinity receptor Trk-A in the rat pancreas during embryonic and fetal life. J Endocrinol 1998; 156:431-9. [98243305]
- Rosenbaum T, Vidaltamayo R, Sanchez-Herrera D, Hiriart M. Nerve growth factor increases sodium current in pancreatic beta cells. J Membr Biol 1996; 153:53-8. [96350962]
- Rosenbaum T, Vidaltamayo R, Sanchez-Soto MC, Zentella A, Hiriart M. Pancreatic beta cells synthesize and secrete nerve growth factor. Proc Natl Acad Sci USA 1998; 95:7784-8. [98301653]
- Kanaka-Gantenbein C, Dicou E, Czernichow P, Scharfmann R. Presence of nerve growth factor and its receptors in an in vitro model of islet cell development: implication in normal islet morphogenesis. Endocrinology 1995; 136:3154-62. [95309212]
- Polak M, Scharfmann R, Seilheimer B, Eisenbarth G, Dressler D, Verma IM, Potter H. Nerve growth factor induces neuron-like differentiation of an insulin-secreting pancreatic beta cell line. Proc Natl Acad Sci USA 1993; 90:5781-5. [93296223]
- Chao MV, Hempstead BL. p75 and Trk: a tworeceptor system. Trends Neurosci 1995; 18:321-6.
- Singh J, Adeghate E, Salido GM, Pariente JA, Yago MD, Juma LO. Interaction of islet hormones with cholecystokinin octapeptide-evoked secretory responses in the isolated pancreas of normal and diabetic rats. Exp Physiol 1999; 84:299-318.
- Rausa FM, Ye H, Lim L, Duncan SA, Costa RH. In situ hybridization with 33P-labeled RNA probes for determination of cellular expression patterns of liver transcription factors in mouse embryos. Methods 1998; 16:29-41. [98450013]
- Tazi A, Czernichow P, Scharfmann R. Similarities and discrepancies in the signaling pathway for nerve growth factor in an insulin producing cell line and a neural crest-derived cell line. J Neuroendocrinol 1995; 7:29-36.
- Hellerstrom CH, Lewis NJ, Borg H, Johnson R, Freinkel N. Method for large-scale isolation of pancreatic islets by tissue culture of fetal rat pancreas. Diabetes 1979; 28:769-76.
- Knaack D, Fiore DM, Surana M, Leiser M, Laurance M, Fusco-DeMane D, et al. Clonal insulinoma cell line that stably maintains correct glucose responsiveness. Diabetes 1994; 43:1413-7.
- Clark SA, Burnham BL, Chick WL. Modulation of glucose-induced insulin secretion from a rat clonal betacell line. Endocrinology 1990; 127:2779-88.
- Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenolchloroform extraction. Anal Biochem 1987; 162:156-9.
- Conover JC, Yancopoulos GD. Neurotrophin regulation of the developing nervous system: analyses of knockout mice. Rev Neurosci 1997; 8:13-27.
- Timmusk T, Belluardo N, Metsis M, Persson H. Widespread and developmentally regulated expression of neurotrophin-4 mRNA in rat brain and peripheral tissues. Eur J Neurosci 1993; 5:605-13.
- Torcia M, Bracci-Laudiero L, Lucibello M, Nencioni L, Labardi D, Rubartelli A, et al. Nerve growth factor is an autocrine survival factor for memory B lymphocytes. Cell 1996; 85:345-56.
- Cho HJ, Kim SY, Park MJ, Kim DS, Kim JK, Chu MY. Expression of mRNA for brain-derived neurotrophic factor in the dorsal root ganglion following peripheral inflammation. Brain Res 1997; 749:358-62. [97439667]
- Zhou XF, Chie ET, Deng YS, Rush RA. Rat mature sympathetic neurones derive neurotrophin 3 from peripheral effector tissues. Eur J Neurosci 1997; 9:2753- 64.
- Zhang SH, Zhou XF, Deng YS, Rush RA. Measurement of neurotrophin 4/5 in rat tissues by a sensitive immunoassay. J Neurosci Methods 1999; 89:69-74.
- Miralles F, Czernichow P, Scharfmann R. Pancreatic acinar AR42J cells express functional nerve growth factor receptors. J Endocrinol 1999; 160:433-42. [99180663]
- De Vicente JC, Garcia-Suarez O, Esteban I, Santamaria J, Vega JA. Immunohistochemical localization of neurotrophins and neurotrophin receptors in human and mouse salivary glands. Anat Anz 1998; 180:157-63.
- Tazi A, Le Bras S, Lamghitnia HO, Vincent JD, Czernichow P, Scharfmann R. Neurotrophin-3 increases intracellular calcium in a rat insulin-secreting cell line through its action on a functional TrkC receptor. J Biol Chem 1996; 271:10154-60. [96215307]
- Scharfmann R, Atouf F, Tazi A, Czernichow P. Growth hormone and prolactin regulate the expression of nerve growth factor receptors in INS-1 cells. Endocrinology 1994; 134:2321-8.
- Scharfmann R, Tazi A, Polak M, Kanaka C, Czernichow P. Expression of functional nerve growth factor receptors in pancreatic beta-cell lines and fetal rat islets in primary culture. Diabetes 1993; 42:1829-36.
- Price P, Baxter AG, Allcock RN, Papadimitriou JM. Factors influencing the effects of murine cytomegalovirus on the pancreas. Eur J Clin Invest 1998; 28:546-53. [98394098]
- Terauchi Y, Tamemoto K, Kadowaki T. New diabetes mellitus models: gene targeting. Exp Anim 1998; 47(Suppl):110-4.
- Hugl SR, White MF, Rhodes CJ. Insulin-like growth factor I (IGF-I)-stimulated pancreatic beta-cell growth is glucose-dependent. Synergistic activation of insulin receptor substrate-mediated signal transduction pathways by glucose and IGF-I in INS-1 cells. J Biol Chem 1998; 273:17771-9. [98316350]
- Bernard C, Berthault MF, Saulnier C, Ktorza A. Neogenesis vs. apoptosis as main components of pancreatic beta cell mass changes in glucose-infused normal and mildly diabetic adult rats. FASEB J 1999; 13:1195-205. [99315535]
- Pick A, Clark J, Kubstrup C, Levisetti M, Pugh W, Bonner-Weir S, Polonsky KS. Role of apoptosis in failure of beta-cell mass compensation for insulin resistance and beta-cell defects in the male Zucker diabetic fatty rat. Diabetes 1998; 47:358-64.
|
